kutemigos563 kutemigos563

12-09-2022
Social Studies

contestada

1.why did the ideas of social darwinism appeal to many americans in the late nineteenth century?

Respuesta :

Otras preguntas

Please help. Will give Brainliest!!

Who threatened the land trade routes to the Far East?

HELP!!!! A student did an experiment to determine the specific heat capacity of an unknown metal. She heated 1.00 x 10- kg of the metal to 225°C and quickly pla

Hydrogen and oxygen react under a specific set of conditions to produce water according to the following equation. 2 H2(g) + O2(g) 2 H2O(g) (a) How many moles o

round off 4,449999 to one place

4y(2 + y) - (3y +3) HELPPP

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein

PLEASE HELP!!!! Quadrilateral ABCD is similar to quadrilateral EFGH. What is the value for x, the length of side CD? A-10 B-16 C-14 D-18

discuss the rule of law as a democratic principle which supports a democracy under its benefits

a woman sold an article for 400.00and made a profit of 25%,Find ty cost price and profit