goalltheway4826 goalltheway4826
  • 11-01-2024
  • Chemistry
contestada

A substance has four times the number of particles as a 12-gram sample of carbon-12. How many moles would be in the substance?

Respuesta :

Otras preguntas

how do you divide 5/8 by 16?
What kinds of details might an author include to depict environment or setting in a prose excerpt
what is 8 5/18 - 3 3/18
Sarah made 12 muffins. She took 3/4 of the muffins to a party. How many muffins did Sarah take to the party?
The money spent on domestically produced final goods and services: Group of answer choices is equal to exports minus imports. is subtracted in the circular-flow
Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of
how was the the united states veiwed by the words as a result of the spanish american war
help please i was absent that day
We are exposed to many __________ throughout our lifetime. According to the text, the most pervasive ones in childhood include the family, the school, peer grou
A crew will arrive in one week and begin filming a city for a movie the mayor is desparate to clean the city streets before filming begins two teams are avaliab