Seudónimo Seudónimo

13-12-2018
Mathematics

contestada

What is the quetient of 17.51 / 3.4?

Respuesta :

alleah77 alleah77

13-12-2018

Answer:

5.15

Step-by-step explanation:

I entered 17.5 slash 3.4 into my TI calculator

Answer Link

ahluwaliariddh ahluwaliariddh

13-12-2018

Answer:

5.15 Hope this helps!!!!!!!!!

Answer Link

Otras preguntas

Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 5

Joni is applying for a position at a local hospital as a receptionist. Which of these factors would have the MOST impact on her ability to do her job? A) her gr

Why are the media biased

how does belle's husband describe scrooge when he sees him?

Triangle MRN is created when an equilateral triangle is folded in half. Triangle N R M is shown. Angle N R M is a right angle. An altitude is drawn from point

Solve the equation using square roots or by factoring

Definition: The term ___ ___ ___ (three words) is another way of expressing Real GDP.

Which sentence best states the main point of "Top of the Food Chain"? O A. The bubonic plague is a dangerous and scary thing. O B. A quick decision can have ser

For a particular Rocky Airlines flight, the plane has 250 seats, 220 tickets have been sold for an average price of $140, the fixed costs per flight are $20,000

Acetylene gas (ethyne; HC≡CH) burns with oxygen in an oxyacetylene torch to produce carbon dioxide, water vapor, and the heat needed to weld metals. The heat of