Memoraysan Memoraysan
  • 11-03-2020
  • Biology
contestada

mRNA is transcribed and created from what molecule?

Respuesta :

Hallberge129
Hallberge129 Hallberge129
  • 11-03-2020

Answer:

RNA Polymerase.

Explanation:

The RNA Polymerase takes the genetic code from DNA and transcribes it into the necessary nucleotides which combine to form mRNA.

Answer Link

Otras preguntas

need mRNA AMINO ACIDS 1.AATACGGGGGCGTAACCACTA 2. GCTAGTACGTGCACATTAGAA
I need help building a computer what are some good parts?
When you brainstorm, you: (A.) give your writing to someone so he or she can give you feedback. (B.) freely write down words and phrases to come up with ideas.
The distance on a map is 4.5 cm. The scale of the map is 1 : 1000. What is the actual distance?. Single choice.
Find the axis of symmetry for the equation in vertex form. y=(x+2)^2+1
PLSS HELPPP ILL GIVE 30 POINTS PLSS its for a test plss SHORT ANSWER QUESTION: Include a Claim, Evidence, Explanation, and Conclusion for full credit. Cells wer
3: Consider molecules of hydrogen (tiny ones) and oxygen (bigger ones) in a gas mixture. If they have the same average kinetic energy (they will at the same tem
What does a generator do?
I try to be nice to others but I get treated like trash my school friend told me tht to get a life am joke ... that’s hurts me alot I get hated on for no reason
The Ring of Fire is an area where many earthquakes and volcanic eruptions occur. True False