ricorico01 ricorico01

11-11-2020
Biology

contestada

What is the allele number for the following sequence? (3pts)
GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

Respuesta :

stefftagalilong stefftagalilong

19-11-2020

Answer:

what I don't understand what is the Ctcagt

Answer Link

Otras preguntas

what happens in hydrolysis during photosynthesis ? plz ans in elaborate form

Name two metals alloyed with iron to make stainless steel.

Using only five odd numbers, add them up so that the result is 32, the five odd numbers have to be whole numbers only.

is 0.7142857.... a rational number? why or why not?

is 0.7142857.... a rational number? why or why not?

Dustin collects football cards. He sells some of his cards. The prices are listed here. $3, $5, $5, $8, $8, $10, $10, $10, $40 What is their mean (average) pric

How is the location of chloroplasts consistent with the function of leaves?

Dustin collects football cards. He sells some of his cards. The prices are listed here. $3, $5, $5, $8, $8, $10, $10, $10, $40 What is their mean (average) pric

Given log 2 = 0.3010, log 3 = 0.4771. Find the value of a) log 12 b) log 5.

What is the Largest Organism?