t0x1cv3n0m2007 t0x1cv3n0m2007

13-01-2021
Mathematics

contestada

Y = -4x + 14

Can you help me

Respuesta :

jennyzback132 jennyzback132

13-01-2021

Answer:

I can

Step-by-step explanation:

If you want to solve for Y its 10

If you want to solve for something else tell me:)

Answer Link

Otras preguntas

Failure to pay on mortgage is called

Marks Corporation has two operating departments, Drilling and Grinding, and an office. The three categories of office expenses are allocated to the two departme

how do these lines demonstrate the political activism of Hughes in his poetry (A) they show that he just liked patriotic songs about the United States (B) they

Define your American Dream. Explain any possible obstacles and adjustments you may have to make in order to achieve your dream in 4-5 well-developed paragraphs

when did truman get congress to declare war on korea

how did plessy vs Ferguson change segregation in the United States

5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’ What is the cellular process shown (mRNA to amino acids?) where in the cell does this process take place?

Which rebellion influence American history ?

Explain how China’s current government was created.

What are three reasons for the need of government and what would happen if there were no government?