Tiya9208 Tiya9208

10-02-2021
Biology

contestada

(Beryllium)
Protons:
Neutrons:
Electrons:
Atomic #:
Atomic mass:
Charge:
Type of atom:
(cation, anion, or neutral)

Respuesta :

SalenaMd SalenaMd

18-02-2021

Answer:

Hope my answer helps you. open the pic

Ver imagen SalenaMd

Answer Link

Otras preguntas

Secor Educational Services had budgeted its training service charge at $120 per hour. The company planned to provide 30, 000 hours of training services during 2

Biography about Thomas Alva Edison 2 paragraphs plsss help mee plsss

QUESTION 1 *Hint: Write this down on paper first, then try to enter your answers." Write and balance the chemical reaction for the combustion of propane gas (C3

Which of the following is the slope of the equation ?A. 7 B. -7C. 9D. -9

our sequence is 5' - cttataaagccgtacaaaatctttctagcgcaaaa - 3'. for simplicity sake, only consider the 5' to 3' direction. consider the underlined c. would a cha

The full cost of attendance to an institute of higher education, including tuition, room and board, books and other costs is known as _____. A. Sticker price B

a taboo system upholds a cultural system and a culture is a pattern of values and norms; social life is impossible without such a pattern. this is the dilemma o

What events were occurring around the time of the publication of Thomas Paine's Common Sense?

interference occurs with not only light waves but also all frequencies of electromagnetic waves and all other types of waves, such as sound and water waves. sup

air flows through a heating duct with a square cross-section with 6-inch sides at a speed of 5.9 ft/s. just before reaching an outlet in the floor of a room, th