z9k8stz328 z9k8stz328

10-03-2021
Chemistry

contestada

HELP DUE IN ONE HOUR PLS HELP
lons are formed when _____
are transferred between atoms.

Respuesta :

soroya5959 soroya5959

10-03-2021

The Answer Should Be Electrons.

Answer Link

Otras preguntas

a narrative essay, the writer should include taste what is going on in the story.

perform experiments with all three excitation wavelengths and write down all the wavelengths of emitted light. do at least 10 experiments. how many different wa

if you're estimating the bias of a coin that came up heads 10 times and tails 20 times, what is the maximum likelihood estimate for the bias of this coin (p(hea

Thin filaments connect to and extend from either side of a _____. These thin filaments are composed largely of the myofilament ____Z disc, actin

what type of conflict centers on objects, events, and persons in the world that are usually, but not always, external to the parties involved in the conflict?

our sequence is 5' - cttataaagccgtacaaaatctttctagcgcaaaa - 3'. for simplicity sake, only consider the 5' to 3' direction. consider the underlined c. would a cha

If ABD=9 GIG=18 ADC=9 Then what is TRUCK?

Two-sevenths of the students in the theater club will be in the second show, and three-fifths of them will be in the third show. The rest will be in the first s

air flows through a heating duct with a square cross-section with 6-inch sides at a speed of 5.9 ft/s. just before reaching an outlet in the floor of a room, th

Choose the equation of a line parallel to the given equation and passing through a point P. -3x - y= -4 ; P = (1,4)