ts606987 ts606987

11-05-2021
Mathematics

contestada

What is the answer to 4 1/3 - 1 1/5

Respuesta :

StormzXX StormzXX

11-05-2021

Answer:

3 2/15 or approximately 3.13

Step-by-step explanation:

4 1/3 - 1 1/5

=13/3 - 6/5

= 47/15

=3 2/15 or approximately 3.13

Answer Link

Otras preguntas

Death Valley has an altitude that is below sea level. Which situation describes a hiker in Death Valley who hikes until he reaches an altitude of 0 feet? A - T

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein

Hi! Please explain how you got the answer, thanks! :))

does people get sad if yes then why

In what ways are Porifera different from other phyla that we will study?

pleaseeeeeeee helppppppp

Which image below shows a line?

What is populism in your own words

Find the quotient using long division 4x^2-11x+5/x-4

Name the Following Binary Ionic Compounds: a. AgCl b. ZnO c. CaBr2 d. SrF2