JacobMcD
JacobMcD JacobMcD
  • 10-11-2021
  • Mathematics
contestada

help with this question

help with this question class=

Respuesta :

DAGOD1 DAGOD1
  • 10-11-2021

Answer:  x=-1-2 square root 7

Step-by-step explanation:

Answer Link

Otras preguntas

Becky has 55 Oreos. She gives her friend some and is left with 13 Oreos. How many Oreos did Becky give to her friend?
Ella es Guapa pls help
Using trawling nets to fish is an example of A. Habitat destruction B. Climate change C. Invasive species D. Pollution
Almost all companies utilize some type of​ year-end performance review for their employees. Human Resources​ (HR) at a​ university's Health Science Center provi
what difference is felt if we stand up with one foot than that with two feet ?​
On January 1, you plan to take a trip around the world upon graduation four years from now. Your grandmother wants to deposit sufficient funds for this trip in
A change in weather is likely coming if a barometer shows a change in __________.
Given the sequence ATGGCGAATCACGTCACTTGA a) Write the sequence of nucleotides for the complementary strand of DNA. b) Write the mRNA sequence transcribed from t
the main word or group of words that tells what the sentence is about
What is the difference between Black Codes and Jim Crow Laws?