10-11-2021
Mathematics

contestada

Orly uses
2 cups of raisins for every
8cups of trail mix she makes. How many cups of trail mix will she make if she uses
10 cups of raisins?

Respuesta :

24draxehayward 24draxehayward

14-11-2021

Answer:

40 cups of trail mix should be used. but this doesn't seem like a college-level question?

Answer Link

Otras preguntas

what is the molarity of a sodium hydroxide solution if 28.7 ml of this solution reacts exactly with 22.30 ml of 0.253 m sulfuric acid?

Atmospheric pressure is also known as barometric pressure because it is measured using a barometer. A rising barometer indicates increasing atmospheric pressure

you find a skeletonized individual out in the desert. you notice that there is beveling around the left glenoid fossa (shoulder socket), the left humerus is hea

electronic watches keep accurate time using crystal oscillators. inside the watch, there is a tiny block of quartz which vibrates. two opposite faces of the blo

our sequence is 5' - cttataaagccgtacaaaatctttctagcgcaaaa - 3'. for simplicity sake, only consider the 5' to 3' direction. consider the underlined c. would a cha

PLEASE HELP 40 POINT PLEASE 40 POINTS ASAP One of the major failures of Reconstruction efforts was that: A. maintaining martial law in the South greatly weakene

the evolutionary mechanism that allows for species to adapt to the environmental conditions found in their habitat is.....

taking the PERT dec 14 whats on the math section

which of the following statements comparing traditional and roth iras is false? multiple choice contributions to traditional iras may be deductible; contributio

In 2018, Spotify was available in many countries around the world. The same year, Spotify offered an attractive deal available only to students—Spotify Premium,