EricUrizz EricUrizz
  • 12-12-2021
  • Mathematics
contestada

Can anyone solve and explain part b

Can anyone solve and explain part b class=

Respuesta :

Аноним Аноним
  • 12-12-2021

Answer:

Below in bold.

Step-by-step explanation:

b.

If we drop a perpendicular line from B to AC and mark the point D on AC, we have 2 right triangles, with AD = DC = 16 cm.

So tan O = BD/16 = 15/8

BD = (16*15)/8

= 2*15

= 30.

So the area of triangle ABC = 16*30

= 480 cm^2.

Answer Link

Otras preguntas

Give an example of where each of the following occurs on our planet Divergent boundaries in ocean crust. Divergent boundaries on continental crust Convergent bo
Which statement correctly describes how a landform is formed?
HELLPPPP ANSWERRR AND EXPLAIN!!!!!​
x + 5 < –4 Solve for x. Answer must be simplified.
What is the complementary strand of DNA to the one below? AAACCGTATCCGCGGTATATCGCCGGAAT
Jamal opened a savings account with $100 at the beginning of the year. At the end of each month, he deposits $25 into the account. Which equation represents the
What was the problem for the United States after the Annexation of Texas? What was the main effect of this action?
Options Nadie Algo O.o Ni....ni Alguna Sino También Tampoco Nada Alguien
you have 6 apples at your house. if you want to pack 3 apple s for a road trip, in how many different combination could you pack the apples?​
Can someone lowkey do this for me lolz