Maariyah123 Maariyah123

10-03-2017
Mathematics

contestada

How do you make a the subject in w=3(2a+b)-4

Respuesta :

10-03-2017

w = 3 ( 2a + b ) - 4
w = 6a + 3b - 4
w + 4 - 3b = 6a
a = w + 4 - 3b / 6

HOPE it helps !!

Answer Link

LamZhaoWei LamZhaoWei

10-03-2017

w=3(2a+b)-4
w=6a+3b-4
6a=w-3b+4
a= square root w-3b+4

Answer Link

Otras preguntas

PLEASE SOMEBODY HELP A moon of mass m orbits a planet of mass M in uniform circular motion with a constant tangential velocity. The distance between the center

Turn "We have already finished our work." into interrogative sentence

Conduction is a direct type of heat transfer where two objects are in contact with each other. Where is in the picture do you see this happening (label and expl

what was the cause of the battle of lake erie

Find the amount of money owed at the end of 3 years if $7,500 is borrowed at 6.5% per year compounded quarterly and no payments are made on the loan. (Simplify

College question need help shark attack probability, in the next year, what is the probability there will be:

CAKE Carl had a piece of cake in the shape of an isosceles triangle with angles measuring 26°, 77°, and 77°. He wanted to divide it into two equal parts, so he

Write an ARGUMENTATIVE essay in response to the following prompt. Should schools get rid of letter grades for assignments? What would be a better alternative to

An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated

P. Choose one topic from the following 'How to ....' list. Work in pairs and take turns to talk about the topic. Use the structures in the box below as a prompt